[Literature] Ruby gene related literature

First publications

He, Y., Zhang, T., Sun, H. et al. A reporter for noninvasively monitoring gene expression and plant transformation. Hortic Res 7, 152 (2020). https://doi.org/10.1038/s41438-020-00390-1

Ruby gene sequence

The 2A peptide sequences of tobacco and Arabidopsis are different. How to design 2A peptide?

We took advantage of the P2A peptide, which has the sequence of (GSGATNFSLLKQAGDVEENPGP), to link the CYP76AD1, DODA, and glucosyltransferase (GT) coding regions. The entire sequence of RUBY and terminator was shown in Supplemental Fig. 1.

The three genes were linked by sequences (red) that encode 2A peptides. Note that the two 2A sequences differed in DNA sequences, but both encoded the same peptide, which had a sequence of GSGATNFSLLKQAGDVEENPGP. The RUBY ORF was followed by the Arabidopsis HSP18.2 terminator.

For rice plasmids, we used F2A peptide (QLLNFDLLKLAGDVESNPGP). The corresponding DNA sequence is: CAATTGTTGAATTTTGATTTGTTGAAGTTGGCTGGAGATGTTGAATCTAATCCTGGAC CT

You can use this for poplar connecting peptide:

Cho JS, Jeon HW, Kim MH, Vo TK, Kim J, Park EJ, Choi YI, Lee H, Han KH, Ko JH. Wood forming tissue-specific bicistronic expression of PdGA20ox1 and PtrMYB221 improves both the quality and quantity of woody biomass production in a hybrid poplar. Plant Biotechnol J. 2019 Jun;17(6):1048-1057. doi: 10.1111/pbi.13036. Epub 2018 Dec 5. PMID: 30515982; PMCID: PMC6523601.

Tobacco-related linker peptide literature:

Zhang B, Rapolu M, Kumar S, Gupta M, Liang Z, Han Z, Williams P, Su WW. Coordinated protein co-expression in plants by harnessing the synergy between an intein and a viral 2A peptide. Plant Biotechnol J. 2017 Jun;15(6):718-728. doi: 10.1111/pbi.12670. Epub 2017 Mar 30. PMID: 27879048; PMCID: PMC5425387.

Codon optimization related websites

The current mainstream codon optimization websites basically use optimization CAI as an indicator, mainly including:

https://www.vectorbuilder.cn/tool/codon-optimization.html
http://genomes.urv.es/OPTIMIZER/
https://climsprod.genewiz.com.cn/Toolbox/CodonOptimization
https://www.genscript.com/tools/gensmart-codon-optimization
http://www.jcat.de/
http://www.detaibio.com/tools/ (powerful function)
1. Thermo’s online tool: https://www.thermofisher.cn/order/geneartgenes
1. Benchling’s online tool: https://www.benchling.com/

IDT’s online tool: https://sg.idtdna.com/pages/too

In October 2021, Zhang He and others published the article LinearDesign: Efficient Algorithms for Optimized mRNA Sequence Design, developing a new algorithm to more effectively optimize mRNA sequences, website http://rna.baidu.com /

Carrier construction

1、Arabidopsis thaliana：plasmid pHDE：_Various promoters can be cloned into the _Pme_I site of _pHDE-RUBY to drive RUBY expression.Transgenic plants for YUC4:RUBY were selected on MS medium containing hygromycin (16.7 μg/ml).

2、rice：pDX2181._To construct the _pDR5:RUBY plasmid, we linked the three betalain biosynthetic genes through 2A peptides. Here, we used the F2A peptide, which has the following peptide sequence: QLLNFDLLKLAGDVESNPGP.

2Apeptide design
Other documents

（one）Wang D, Zhong Y, Feng B, et al. The RUBY reporter enables efficient haploid identification in maize and tomato[J]. Plant Biotechnology Journal, 2023.